онлайн-центр иностранных языков Мультиглот



Это интересно

Изменчивость организмов

Тема. Изменчивость организмов

Автор: Козленко А.Г.

Тип урока: Урок обобщающего повторения; индивидуальная (групповая) работа, компьютерный класс с мультимедийным проектором.

Цели занятия:

  1. При подготовке к экзамену повторить и закрепить знания по теме «Изменчивость».

  2. Решать задачи морально-психологической подготовки к экзамену, преодоления ситуаций длительного неуспеха, устойчивость к стрессовым ситуациям.

  3. Продолжить формирование навыков эффективной работы с компьютерным курсом «Подготовка к ЕГЭ: Биология», в частности – формирование серьезного отношения к компьютерной форме предъявления тестовых заданий и повышение эффективности работы с вариантами тестов.

Основные понятия. Модификация. Вариационный ряд, вариационная кривая. Мутация. Мутаген. Комбинативная изменчивость.

Мировоззренческий и развивающий аспекты урока. Повышение эффективности работы с электронными пособиями, более качественное использование их достоинств и возможностей.

Использование новых информационных технологий. Компьютерный класс, имеющий рабочие места перед компьютерами и обычные столы для лекционной работы (или мобильный компьютерный класс), мультимедийный проектор; курс «Подготовка к ЕГЭ: Биология» (сетевая версия).

План урока.

Этапы урока

Время, мин.

Приемы и методы

I. Организационный момент. Мотивация учебной проблемы

2-3

Пояснение цели и структуры занятия, формы его проведения, правила заполнения бланка

II. Разделение учащихся на группы по формам работы

2-3

Распределение заданий

III. Выполнение заданий: работа групп

(10-12)×2

Работа с курсом «Подготовка к ЕГЭ. Биология»

IV. Обобщение итогов, уточнение вопросов и проблемных мест

5-7

Записи на интерактивной доске

V. Индивидуальная работа с поисковой системой курса

7-10

Групповая/парная работа с курсом «Подготовка к ЕГЭ. Биология»

VI. Итог урока. Домашнее задание

2-3

Рекомендации учителя

Занятие рассчитано на один академический час в кабинете информатики, имеющем рабочие места перед компьютерами и обычные столы для лекционной работы. Указанное время каждого этапа ориентировочное.

I. Организационный момент. Мотивация учебной проблемы

Пояснение цели и структуры занятия, формы его проведения.

II. Разделение учащихся на группы по формам работы

Часть учеников работает индивидуально с компьютером, другая – фронтально, с заданиями, демонстрируемыми через мультимедийный проектор или индивидуально, по распечатанным заданиям.

III. Выполнение заданий: работа групп

1. Индивидуальная работа с курсом: прохождение тестов к разделу 3.6., при необходимости – обращение к краткому конспекту и повторное выполнение тестового задания, только после этого – обращение к решению. Решение примеров заданий А9, А30, В1, В6, В7, С1, С2.

2. Работа с распечатанными задачами: индивидуальное/парное решение задач с таблицей генетического кода, по роли отдельных мутаций в изменении последовательности аминокислот кодируемого белка. Примеры задач (С5):

Все приведенные в задачах последовательности нуклеотидов – фрагменты и-РНК.

1. Переведите приведенную ниже последовательность иРНК в белок. Запишите полученный белок. А теперь попробуйте удалить первые два нуклеотида и получить другой пептид. Запишите полученный пептид и сравните с первым.

UAUGCUAAGAUUCCUUUCGGA

2. Переведите приведенную ниже последовательность иРНК в белок. Запишите полученный белок. А теперь попробуйте заменить в 6-й позиции C на G и получить другой пептид. Запишите полученный пептид и сравните с первым.

AUGUACCGUAUUCCAGAGCAU

3. Необходимо по молекуле белка восстановить последовательность нуклеотидов (точнее, один из возможных вариантов состава) иРНК:

Аминокислоты: Метионин - Аргинин - Лизин - Валин - Триптофан - (стоп-кодон)

Какие аминокислотные замены могут произойти при замене A в 7-й позиции на C, на U, на G?

Ответы:

1. Тир-Ала-Лиз-Иле-Про-Фен-Гли

Цис-стоп-кодон

2. Мет-Тир-Арг-Иле-Про-Глу-Гис

Мет-(стоп-кодон)

3. Лизин заменится на глутамин (при замене на C), на стоп-кодон (при замене на U), на глутаминовую кислоту (при замене на G)

После выполнения заданий части класса меняются местами.

IV. Обобщение итогов, уточнение вопросов и проблемных мест.

Учитель показывает отдельные задания разных типов, обращая внимание на особенности их выполнения (подборка из 5-7 заданий разных типов по данной теме).

A9 (134135)

Синдром Шерешевского–Тернера связан с утратой одной X хромосомы. Как в таком случае выглядит кариотип больного?

Х0

ХY

ХХ

ХХХ

A9 (134137) A9

У родителей с нормальным кариотипом родилась девочка, в диплоидных клетках которой обнаружили три X-хромосомы. С какой формой изменчивости мы имеем дело?

Мутационной

Модификационной

Комбинативной

Случайной фенотипической

A30 (134140)

Изобразим один из фрагментов хромосомы в виде следующей последовательности ее участков: ABCDEF. Укажите изображение видоизмененного фрагмента, если произойдет дупликация – удвоение одного из участков этого фрагмента хромосомы.

ABCDCDEF

ABEF

ABCDEFP

ABDCEF

A30 (134141)

Из предложенных статистических рядов укажите тот, который вариационным не является.

Распределение новорожденных девочек по весу в городе М

Распределение проживающих в горах женщин по количеству эритроцитов (млн в 1 мм3) в крови

Распределение заболеваемости людей гриппом в городе К (на 1000 жителей) по месяцам за последний календарный год

Распределение собак одной из пород по количеству детенышей в помете

B1 (134143)

Какие из перечисленных факторов являются мутагенными:

1)

рентгеновское излучение;

2)

тепловое излучение;

3)

колхицин;

4)

сахароза;

5)

этиловый спирт и продукты его метаболизма;

6)

жирные кислоты.

Правильный ответ: 135

B6 (133760)

Установите соответствие между свойствами мутации и ее типом.

Описание.

А.

Передаются следующему поколению при половом размножении.

Б.

Передаются следующему поколению при вегетативном размножении или не передаются следующему поколению вовсе у видов, которым присуще только половое размножение.

В.

Часто происходят в гаплоидных клетках.

Г.

Происходят в гаметах или клетках–предшественницах гамет.

Д.

Вызывают «мозаичность» организма.

Е.

Часто служат причиной развития злокачественных опухолей.

Тип мутации:

1)

соматическая;

2)

генеративная.

Правильный ответ: 212211

B7 (133761)

Расставьте мутации в порядке возрастания вовлеченного в нее генетического материала.

А.

Точечная замена нуклеотида.

Б.

Встраивание в хромосому вирусной ДНК.

В.

Делеция триплета.

Г.

Трисомия (в клетке присутствует не 2, а 3 гомологичных хромосомы).

Д.

Полиплоидия.

Правильный ответ: АВБГД

B7 (133762)

Расставьте перечисленные ниже признаки в порядке возрастания нормы реакции, то есть в порядке расширения диапазона, в котором эти признаки могут проявляться в разных условиях среды. (Подразумевается, что независимо от того, о каких физических или физиологических характеристиках идет речь, признак, изменяющийся в диапазоне ±10 %, обладает меньшей нормой реакции, чем признак, способный изменяться в несколько раз).

А.

Химический состав молекул гемоглобина.

Б.

Температура тела.

В.

pH крови.

Г.

Количество ударов сердца в минуту.

Д.

Артериальное давление.

Правильный ответ: АВБДГ

С1 (133763)

Почему наследственную изменчивость называют также неопределенной изменчивостью?

Решение.

1 Наследственная изменчивость появляется благодаря возникновению мутаций.

2 Хотя появление мутаций и зависит от условий внешней среды, они появляются ненаправленно: невозможно предугадать, какой именно ген будет подвержен мутации, и ее фенотипическое проявление никак не связано с вызвавшим фактором (мутагеном). Именно поэтому наследственная изменчивость иногда называется неопределенной изменчивостью.

V. Индивидуальная работа с поисковой системой курса.

Групповая/парная работа: поиск по заданиям, по ключевым словам, и выполнение вразброс. Отдельные персональные задания по разным типам заданий (например, для девушек – единственный выбор, часть А, и множественный выбор, В1; для юношей – задания части С и В6-В8).

Поисковая система курса и задание, открытое из результатов поиска

Для остальных учащихся (особенно тех, кто не сдает экзамен по биологии) возможна организация партии в настольную игру «Генофонд» (Gene Pool), которая моделирует поиск маркерных последовательностей различных наследственных заболеваний (см. http://www.kozlenkoa.narod.ru/photoalbum.htm#2-01).

VI. Итог урока, домашнее задание.

Материал конспекта, работа со сложными терминами темы по алгоритму Цицерона.

Определение термина «Мутация» по алгоритму Цицерона (объект из «Открытая Коллекция. Биология: 9 класс»)

Используется модель из Открытой Коллекции: Биология, 9 класс (Волки, кролики и капуста) - 96375.

В интерактивном учебнике «Открытая биология 2.6» представлены две разных модели, и расположенный на диске с учебником урок (достаточно тщательно задающий отдельные шаги работы, значения скоростей размножения и численностей популяций) также по двум моделям. На рекламном же диске приводится общая модель трех популяций одновременно, и план урока скорректирован с учетом этого

Правильный ответ.